Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF395
Clone ID RRF395
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF395
Sequence
ACTTTGCCTGTCACCCTAACGGAATGGAAACTGTTCCGAGCTGGAGAGGTGGCTAACAAGAAGAAGAGAAATCTCCCACC
GCTTGTTTTGAAAATAAATGATACATTTGAATCTAAGAGAGGGAAGAAGAGGGTAAAGTTACAGCCTTACACTGGAAAGG
TAGCCCCCTCTTTTCCAGGTGAAACCAGTGGGAACGAGAGCGATGCCGAGTACCTGCCAAAGAATCGCCACAAGCGCTTG
GCACAGCTGCAGCCGTCCTCCAAGAGGAACCCCCACTACCAGACCTTGGAGCGCGACCTCATTGAGCTACAGGAGCAGCA
GCTCTTTGAACTCTTCGTGGTGGTTTCTCTGCAGAAGAAGCCGGCAGGGTACACTCCCCAGGTCATACAGCAGTTCCCTA
GCA
Sequence Type mRNA
Unitrap ID UNI8320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102941156..102953143 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es