Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF400
Clone ID RRF400
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF400
Sequence
AGGAGAAGCAGTTGTGGGTGACTCAGCTTCGAGCGTGCGCCAAATACCACATGGAGATGAGTTCCAAGACTACTCCAGGC
TCCCGCAGCCGAAGCCTCACTTTGCTCCCCCATGGAACACCCAGTTCTGCGTCTCCCTGTAGCCAGAGACATCTCAGTAC
GGGCGCCCCCGGTGTTGTCTCAGTCACGCGTCACAAGTCGCCTGCAGCTGCCCGAAGAGCCAAGAGTCAGTATTCCGGCC
AGCTTCACGAAGTCAGAGAGATGATGAACCAGGTGGAAGGCCAGCAGAAGAACCTCGTGCATGCCATTGAGTCCCTGCCA
GGCTCGGGCCCCCTCACTGCCTTGGACCAGGACCTGCTTCTCCTGAAGGCTACCTCTGCCGCCACCCTCAGCTGTCTTGG
GGAGTGCCTCAGCCTGCTTCAGCAGAGTGTGCGCCAGGCAGCGCCACCCAGCCACAAGCCAGGCGCCT
Sequence Type mRNA
Unitrap ID UNI8321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114976376..115076407 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040875 (Osbpl10) NM_148958 oxysterol binding protein-like 10 Gene [Source:MGI Symbol;Acc:MGI:1921736]

 
Come back to gene ENSMUSG00000040875


For any suggestions or comments, please send an email to unitrap@crg.es