Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST85730
Clone ID OST85730
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST85730
Sequence
AACACTGACGGGTACNTCCGCTGNATCTCNTATCCATAGATTTGCTCCCACGCATCAGCCACATCACTGTGCGCCTGCTC
GACCCCGGGCCTGAGCAGGGGTGCCAAATCTCCCACTATACCTGAGCACCGGGAGCTTCCAGAGCACGCCTGCCTCCCTC
CCTCTAGTCTGCATGTGTGCAAGGATGTCAGACAGTCTCGACTTAGGATGGACAGACACAGAGGGGTGCCTTCTATGGTG
CCAGCCTGTCATGCCCAGTCCCTCCCATCAGTGCCCTGGGCCTGTCCTGGGTCCCCTGACACATTACTTGCCCTTTTATA
CAATTTTCAATTAAAACACCTATTTTG
Sequence Type mRNA
Unitrap ID UNI21265

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28090162..28090507 319
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es