Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone STA117
Clone ID STA117
Vector pGT2TMpfs
Project baygenomics

Sequence tag STA117
Sequence
GCGGACCTGGGGATTAATGGGAAAAGTTTTGGCAGGAGCTGGGGGATTCTGCGGAGCCTGCGGGACGGCGGCAGCGGCGC
GAGAGGCGGCCGGGACAGTGCTGTGCAGCGGTGTGGGTATGCGCATGGGACTCACTCAGAGGCTCCTGCTCACTGACAGA
TGAAGACAAACCCACGGTAA
Sequence Type mRNA
Unitrap ID UNI8333

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28369712..28374038 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002250 (Ppard) NM_011145 peroxisome proliferator activator receptor delta Gene [Source:MGI (curated);Acc:Ppard-001]

 
Come back to gene ENSMUSG00000002250


For any suggestions or comments, please send an email to unitrap@crg.es