Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone ST531
Clone ID ST531
Vector pGT1.8TM
Project baygenomics

Sequence tag ST531
Sequence
AAGAACATAAATCACAGAAGATTTGCTGCCTCTTTCAGATTGCAAGAAGTGACAAAAACTGACCAGGATTTGTACCGCTG
CGTAACTCAGTCAGAACGAGGTTCTGGGGTTTCCAATTTTGCTCAACTCATTGTGAGAG
Sequence Type mRNA
Unitrap ID UNI8340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 28074447..28074585 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]

 
Come back to gene ENSMUSG00000019889


For any suggestions or comments, please send an email to unitrap@crg.es