Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST84603
Clone ID OST84603
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST84603
Sequence
GAACTGAGAGATCCTGTNTATTTCGACGATAATTGGCTAAACAGCAATCAAAACTGAAGTAGGAGACAATTGGAGGTTAA
AGATCAGCAATTTAAAGAAAATTTTAAAAGGCATCTTGGATTACAATCATGAGATTTTAGGACAGCAGATTAATGATTTC
ACCCTTCCTGACGTGAACCTCATTGGGGAGCATTCGGATGCAGCAGAGCTCGGAAGGATGCTGCAGCTCATTCTAGGCTG
TGCTGTGAACTGTGAGCAGAAGCAAGAGTACATTCAAGCCATTATGATGATGGAGGAATCTGTTCAGCATGTCGTCATGA
CAGCCATTCAAGAGGTATGTTGATTAGAGCTTTGCACTTAACAGCTTGTAACAAATTAGTGGAGAAAACTAGTTCTCACA
AGAGAAATGGCAACCTTAAAAAATTATTTTATTGTCTATACCTATATCCTAATTAAGTTTTTAAGTTCACTGTGAAAAAA
AAAAA
Sequence Type mRNA
Unitrap ID UNI26934

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27192846..27206304 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es