Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone STA016
Clone ID STA016
Vector pGT2TMpfs
Project baygenomics

Sequence tag STA016
Sequence
CTCGGTCCCATATTGAACTCGAGTTGGAAGAGGCGAGTCCGGTCTCAAAATGG
Sequence Type mRNA
Unitrap ID UNI5036 UNI5037 UNI5038 UNI5039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8784177..8784229 53
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114538905..114538957 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66639847..66639899 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12159931..12159983 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060989 (AL805912.5)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54285339..54285391 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069014 (AC121785.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77702029..77702081 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067669 (AL844863.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75497326..75497378 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059005 (Hnrpa3) NM_146130 heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI (curated);Acc:Hnrpa3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 145530311..145530363 53

 
Come back to gene Mm.390794


For any suggestions or comments, please send an email to unitrap@crg.es