Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST84318
Clone ID OST84318
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST84318
Sequence
ACTGAGTTGCCAAACAAAGAGGATTTAGAGATGGAGGCTTTGTTGGAAGGAATACAAAATCGGGGGCATAGTGGGGGATT
TTTGACATCCTGTGAAGCAGAACTGCAAGAGCTCATGAAACAGATCGATATAATGGTGGCTCATAAGAAGTCGGAGTGGG
AGGGGCAGACGCACGCTCTGGAGACTTGCTTGGACATCCGTGATCGGGAGCTGAAGGCTCTGAGGAGTCAGCTGGACATG
AAGCACAAAGAGGTAGAGCGGCTGCTTCACTTCTCTTGTTATCTTGACTCTGGCTTTAAATCATACATGGTTCCATACAC
CCATGTTCATGCATGTATATAATATACTTGGAGCAACCCATGTCCAAACCTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102521018..102522092 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032534 (AL450317.13) NM_001081122 centrosomal protein 63 [Source:RefSeq peptide;Acc:NP_001074591]

 
Come back to gene ENSMUSG00000032534


For any suggestions or comments, please send an email to unitrap@crg.es