Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone STA057
Clone ID STA057
Vector pGT2TMpfs
Project baygenomics

Sequence tag STA057
Sequence
CCGGGAACTGAGCATTGCTGTCTCTGAAAAATGAATCTCAGTATGAAGCAGAAGCAGGAGGGAGCCCAAGAGAATGTGAA
GAATAGTCCTGTCCCAAGGAGAACGCTGAAGATGATCCAGCCTTGTGCAGATGGATCTCTTGTTGGCAGAGAAAATGAGT
TGCCAAAAGGCTTGTTCAAAAGGAAGCTTTGGGATGACCAGCTAGCATCTCAGACTTCAAGCTGTGGTCCAGAAGCTAAT
GAAAATAAGGATGTTGGAGACCTCACCCAGGAAGCCTTTGATCTTATAAGTAAAGAGAACCCATCTTCTCAGTATTGGAA
AGAAGTGGCAGAGCAGCGGAGGAAAGCTCTCTACGAAGCGCTGAAAGAGAATGAGAAACTTCATAAAGAAATTGAACAAA
AGGACAGTGAGATTGCCCGCCTGAGAAAGGAGAATAAAGACTTGGCAGAAGTAGCTGAGCATGTGCAGTACATGGCGGAG
GTAATCG
Sequence Type mRNA
Unitrap ID UNI8024

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24845219..24853704 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006715 (Gmnn) NM_020567 geminin Gene [Source:MGI (curated);Acc:Gmnn-001]

 
Come back to gene ENSMUSG00000006715


For any suggestions or comments, please send an email to unitrap@crg.es