Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST83871
Clone ID OST83871
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST83871
Sequence
GAACTGAGGCTGAGAGCTCANACAAAACAGCAGCNTCTTANAATATAAGTCCATGATCGACACAAATGAAGAAAAAACTC
CAGANNGGGATTATGCAAGAAAAACAGATCGAAGTTAAAATNGAAGAGCTGGANAATGAAATTGAAGATGTNCAAAGTAA
TATTGAAATGAAAAGTCTTGCNCTGAGCAGGATGAAACTTTCAGTTGCACTTCGGGATAACATGGAGAACATGGGACCTG
AGAATNGGGGGCTCACAGATGACATGAAGCACATATTAAAGCTACAAAAGTTAATAATGAAGNCCCAGGAGGANTCTTCA
GAACTGGAGAAAAAGCTGCTTGATGTCANAAAGAAGAGACTACAACTATAGCAAGCTTCAAGAANTAANCTTTTAGAAAT
ACAAATCGNCTAANAACACACAGAAANAGGATGTTGACAAGATGGAGAATTCTG
Sequence Type mRNA
Unitrap ID UNI26940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101531790..101542738 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045273 (Cenph) NM_021886 centromere protein H Gene [Source:MGI Symbol;Acc:MGI:1349448]

 
Come back to gene ENSMUSG00000045273


For any suggestions or comments, please send an email to unitrap@crg.es