Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XM176
Clone ID XM176
Vector pGT0Lxf
Project baygenomics

Sequence tag XM176
Sequence
AGTGTGATTTCAGTGTGCCGTGCCGCACCAGTTGCGGGTGACAATGCATCGGATA
Sequence Type mRNA
Unitrap ID UNI8353

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108199225..108199278 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032607 (Amt) NM_001013814 aminomethyltransferase Gene [Source:MGI Symbol;Acc:MGI:3646700]

 
Come back to gene ENSMUSG00000032607


For any suggestions or comments, please send an email to unitrap@crg.es