Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0067
Clone ID CA0067
Vector pGT0lxf*
Project sanger

Sequence tag CA0067
Sequence
GCCCGGGATCTACTACCCCCCCATTTGTCTTTGGATCTCGCTATCGATCGGTATCTACTTATGTCTCCTCCCCTCAGGTC
TTATCCTCTGCTGTTCATTTGTTATTCCCTCTCTCTCGGGCCAGACCCAGCATCAATCCTCAGGAAAGGGAAAGTTTTTC
TTTTTGATGGAATTACAGCGGGGACGGAGAAGCGCGAAGCCCAAACATCAAGCAATGGTACCTTTTTTTTTCTCCACAGA
CCAGGGCACAGTCAGAATTTACCCCGCGCATCATGGACGAACTTTTTTTTTTTTTTTTAAACTTCCCCGGGGGGGAGAAA
GAACCGGACCCCGCGGATTGAGGTTGAATTTTTTTTTTTTTTTTCCTTTTCTGGTCTATTGAGAAGATAGTGTTCACGGG
GAAGGAAGGGAAGAGCTCTCAGGGCTGCCCGGTCGCCAAGTGG
Sequence Type mRNA
Unitrap ID UNI875

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62295642..62301155 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047146 (AC166359.3) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9CY36]

 
Come back to gene ENSMUSG00000047146


For any suggestions or comments, please send an email to unitrap@crg.es