Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST82674
Clone ID OST82674
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST82674
Sequence
GACCCAATGATGCTTCTATGTCCCCCAAGGCCCTTGGGAGGAGAGCTGCACAGCATTCAGGCCTCATACCAGGCAGACAC
TGGGTGTGGGTCGGNCACCCAGTCCTGCTCCTCACTCAGGGTGCCAGCTCTGCCTTGAATTTTGTGAACACCAGCACATA
CCTCCTTGTGCCTNTGTCTATACCGAGCTGNTACTGCAGGGGAATGACTCTCACTCACACCCTCCCTGCATGGAGCTCCA
GCGAGTGGACTCAGAGGAGTCTATCAGAATGATCTGGCAATCCTAGCCCCAGCCT
Sequence Type mRNA
Unitrap ID UNI14952

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28385598..28385892 287
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031490 (Eif4ebp1) NM_007918 eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267]

 
Come back to gene ENSMUSG00000031490


For any suggestions or comments, please send an email to unitrap@crg.es