Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH746
Clone ID XH746
Vector pGT1Lxf
Project baygenomics

Sequence tag XH746
Sequence
CCCCACTCACCTGTTGCAGGGATCCCCACTCCCCCCATGACGCCCGGGAGCAGCATACCTCCCTATCTGTCCCCCAGCCA
AGATGTCAAACCACCTTTCCCACCTGATATCAAGCCAAATATGAGCGCTCTGCCACCACCC
Sequence Type mRNA
Unitrap ID UNI8374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 26470735..26470875 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007817 (Zmiz1) NM_183208 zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

 
Come back to gene ENSMUSG00000007817


For any suggestions or comments, please send an email to unitrap@crg.es