Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRD085
Clone ID RRD085
Vector pGT1Lxf
Project baygenomics

Sequence tag RRD085
Sequence
CAGTCTGAGAGCCACAGCAGAGGAACTGGCTCAGGTGAGGCGAGCTCCTGAGGAGATCCGGACCGCACAGGCGTGAGGAC
CAGAGGAGGGCCGTCGCCGCCTCGCGCGCAGCCGACCGCCATGAAGCCCCCCG
Sequence Type mRNA
Unitrap ID UNI176

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80532889..80533020 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004929 (Thop1) NM_022653 thimet oligopeptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1354165]

 
Come back to gene ENSMUSG00000004929


For any suggestions or comments, please send an email to unitrap@crg.es