Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST81417
Clone ID OST81417
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST81417
Sequence
ACCGTTTATGAAACCAGCTGACCTACCTGAGGATGATCAAGCAGAGNTTGATGCGGAGGAACTGANCAGCACANGCAGTG
GAACACATCATTGTCAACCCCAACGCTGCCTACGACAAGTTCAAGGACAAGAGAGTGGGAACAAAGGGGCTTGATTTCTC
AGATCGCATTGGAAAGACCAAGAGGACAGGATATGAGTCTGGAGACTATGAAATGC
Sequence Type mRNA
Unitrap ID UNI26966

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126704487..126712111 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025410 (Dctn2) NM_027151 dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]

 
Come back to gene ENSMUSG00000025410


For any suggestions or comments, please send an email to unitrap@crg.es