Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CA0053
Clone ID CA0053
Vector pGT0lxf*
Project sanger

Sequence tag CA0053
Sequence
CGACTCTCTGCTTGGCCAGTGCATGTACTTTGGGCTGTCCTTTAGCCGGGTGGGGGCTGATTTCCGCGGCCAGTTGGCTC
CTGTTTTCCAGAGGGTGGCAATCAGCACTTTCCAGAAAGCAGTTGAAGAAGCAGTGGAGAAATTCCAGGATGAAATGACT
TCATACACCCTCATCTCGACTGCAGCCATCCTGGGCAGCAGTAACACGCCTGCCACAGTACCAGCCACACAACCAGGCAC
GCTGCAGCCACCGATGGTGCTCTTAGACTTCCCGCCTCTTGCCTGTTTCCTCAACAACATTTTGGTTGCTTTCAATGATT
TACGTCTCTGTTGCCCTGTGGCTCTAGCACAGGATGTGACTGGGACCTTGGAAAATGCCCTTACCAAG
Sequence Type mRNA
Unitrap ID UNI879

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109576113..109576499 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031916 (Cog8) NM_139229 component of oligomeric golgi complex 8 Gene [Source:MGI (curated);Acc:Cog8-001]

 
Come back to gene ENSMUSG00000031916


For any suggestions or comments, please send an email to unitrap@crg.es