Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST81234
Clone ID OST81234
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST81234
Sequence
AACTGAGGTTGTATCAGAGTAAGATGGACGGTAGCTTTGACTGTGATTGTGGTGAGCTGGAGCCACCTGATCACTAAGAA
GAGACGTCCATCAGCCAACGTCACCAGGGCTTCCTGTTGAAACACAGCGACAAGGAAGCGAGGAAGCAGAGGGAACTAGT
GCTTCCCAGCGCCTTAGGATGCTGCTCAGGACCAGTCCAACACTGAATGTATCTGCACTGTGAGAGGATGTCCACGGAGG
CCTGCCGGGCGCATATTTATTCACAGTTTTGTCCCATGTTAAGTCGGTTAGCATAGTAAATCTGAGTGCATACTATGTCA
TTT
Sequence Type mRNA
Unitrap ID UNI10483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75246243..75246560 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042688 (Mapk6) NP_081694 mitogen-activated protein kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1354946]

 
Come back to gene ENSMUSG00000042688


For any suggestions or comments, please send an email to unitrap@crg.es