Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST81155
Clone ID OST81155
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST81155
Sequence
TACTGAGATTGGTCAAAGAAAGAGTGATGTACGAAAAAGAAGCAAAGCAGCAAGAAGAAAAGATTGAAAAAATGAAGGCT
GAAGATGGAGAGAACTACNGCCATTAAGAAGCAGGCAGAGATCCTGCAAGAGTCCCGGATGATGATCCCAGATTGCCAGC
GTCGGTTAGAGGCTGCATATACTGATCTTCAGCAGATATTAGAAAGTGAAAAAGACTTGGAAGAAGCCGAGGAGTATAAA
GAAGCCCGTGTAGTGCTGGATTCCGTAAAGCTAGAAGCCTGACATTTTTCTGTATGGGATGTTTTTTTGCATTAAATCCT
GGGGTCCATTCTACAATTCATTGTTTTCAGCCACTGCTGTGTTTAATAATATGAAAACGTGGTTCTTTTTATGCAGTTGC
ATTTATTTTTCTTTGCATAACTTAATGTGTCAAATAAATGAGTTCATCTAATAAAATTGNTTGTTTTATACTTTAAAAAA
AAAAA
Sequence Type mRNA
Unitrap ID UNI16102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95602313..95612883 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042043 (Tbca) NM_009321 tubulin cofactor a Gene [Source:MGI Symbol;Acc:MGI:107549]

 
Come back to gene ENSMUSG00000042043


For any suggestions or comments, please send an email to unitrap@crg.es