Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST80899
Clone ID OST80899
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST80899
Sequence
GGAGAGGATGTGTTTGGAATCACTGTACCTCTAATTACAAGTACAACTGGAGCAAAGCTGGGAAAGTCTGCTGGCAATGC
GGTTTGGCTAAACAGAGAGAAAACATCACCGTTTGAACTTTATCAGTTCTTTGTCAGACAGCAAGATGATTCCGTAGAAA
GAGATCGATCACATCATGCAGCTACATGTCAAAGAACCAGAAAAGCGAGTTGCTCAGAAACGACTTGCTGCAGAAGTAAC
AAAGCTTGTTCACGGACAAGAAGGTCTGGACTCTGCTAAAAGGTGTACACAAGCCCTTTACCATAGCAGCATAGAGGCAC
TGGAGGTCATGTCTGACCAAGAGTTAAAAGAATTGTTTAAAGAAGCTTCATTTTCTGAATTAGTTCTTGATCCTGGAACG
AGTGTCATAGACACATGCCGTAAAGCAAATGCCATTCCTGATGGCCCTCGAGGGTATCGGATGATAACAGAAGGTGGAGT
CAGTATAAATC
Sequence Type mRNA
Unitrap ID UNI11158

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16304636..16309462 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022792 (Yars2) NM_198246 tyrosyl-tRNA synthetase 2 (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1917370]

 
Come back to gene ENSMUSG00000022792


For any suggestions or comments, please send an email to unitrap@crg.es