Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK477
Clone ID RRK477
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK477
Sequence
GAAGAGACACTAGAAGTCACCCAAAGCAGCCCAGCTTCTGACGAGT
Sequence Type mRNA
Unitrap ID UNI8404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93748341..93748386 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059474 (Mbtd1) NP_598773 mbt domain containing 1 Gene [Source:MGI (curated);Acc:Mbtd1-009]

 
Come back to gene ENSMUSG00000059474


For any suggestions or comments, please send an email to unitrap@crg.es