Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST80282
Clone ID OST80282
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST80282
Sequence
ATGTGCCTGGCCATTCAGACNTCCTCTNGTTGAAGAACCGGTGCCTGACCATGCTCCCTGACCTCCAGCCCCTGGAGAAA
ATACATGGACATAGATCTGTCCACTCAGACATCCTTTCCTTGGAGAACCAGTGTCTGACCATGCTCTCTGACCTCCAGCC
CACGGAGAGAATAGATGGGCATATATCTGTCCACCCAGAC
Sequence Type mRNA
Unitrap ID UNI26983

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 51488018..51488217 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006281 (Tep1) NM_009351 telomerase associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:109573]

 
Come back to gene ENSMUSG00000006281


For any suggestions or comments, please send an email to unitrap@crg.es