Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST80209
Clone ID OST80209
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST80209
Sequence
AACTGAGACTATGCAAGCTGNGAGGTGCCCTACTGATGAATTATCTTTAAGCAACTGTGCGGNTGNGAACGAAAAAGATT
GNCAGTCTGGCCAGCATGTGATGGTGAGGACNTCCCCCAATCACAAGTACATATTTACGCTGAGGACCCATCCGTCAGTG
GTTCCAGGATGCATCGCGTTCAGCTTGCCTCAGCGAAAATGGGCTGGACTTTCTATTGGACAGGACATAGAAGTTGCCTT
GTATTCGTTTGACAAAGCCAAGCAGTGCATCGGCACAATGACCATCGAGATCGACTTCCTGCAGAAGAAGAACATCGACT
CCAACCCTTACGACACCGACAAGATGGCCGCCGAGTTCATCCAGCAGTTCAACAACCAGGCCTTCTCAGTGGGGCAGCAG
CTTGTCTTTAGCTTCAATGATAAGCTCTTTGGATTACTGGTGAAGGACATTGAAGCCATGGATCCCAGCATCCTGAAGGG
AGAGCCTGCATCAGGCAAA
Sequence Type mRNA
Unitrap ID UNI16084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103775124..103792131 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es