Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST80112
Clone ID OST80112
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST80112
Sequence
AACTGAGCTGAGCATGAACGACTTCAGTGTGCNCAGGATCATCGGCCGAGGAGGGTTTGGGGAANTTTATGGCTGCAGGA
AAGCAGACACCGGTAAAATGTATGCCATGAAGTGCTTAGACAAGAAAAGGGTGAAGATGAAGCAGGGGGAGACTCTGGCT
TTGAACGAGAGGATCATGCTGTCTCTCGTTAGCACTGGGGATTGTCCCTTTATTGTCTGCATGACCTACGCCTTCCACAC
GCCGGACAAACTCTGCTTCATCCTGGACCTGATGAACGGAATGAAATATCTCCTGAAAACGTAGGCCAAAGACGCGTTTA
GAAGCTGGCTCTCAAGGGCTGATTTGTGTGGATTCTGCCTTTTATTTCCCTGTCTCCTGAGTCTTCAGGACTCTGCGTTC
ATCTCTGAAAACGTGAACAGCCACCCAAAAAGGCACAGACACAAAACGTTCATCCGGAAAATGCTTTCAGTGTGCAAATG
TGGTATCTGAG
Sequence Type mRNA
Unitrap ID UNI26986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 113375073..113384277 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042249 (Adrbk2) NM_177078 adrenergic receptor kinase, beta 2 Gene [Source:MGI Symbol;Acc:MGI:87941]

 
Come back to gene ENSMUSG00000042249


For any suggestions or comments, please send an email to unitrap@crg.es