Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST80086
Clone ID OST80086
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST80086
Sequence
TCCTGGTCCCCCTGGAACCTGGTCAGCTTCGCTGTCGGCTTCTCTGATGATGTGCAGAGCATCAACTGGCATGGGGGATG
GGGTGCAGCTGGTGGAGAGCANCCGTACCCGCATCACAGGGGAGGAGGTGGAGGTGCGGNACTCCATCCCCGCTGACTCT
GGCCTCTACCGCTTGCGTGACCAGCAGCCCCTCTGGCAGCGATACCACCTACTTCTCCGTCAATGTCTCAGATGCACTCC
CATCCTCGGAAGATGATGACNACGACGATGACTCCTCCTCGGAGGAGAAAGAGACGGACAACACCNAACCAAACCNGTGG
CCTGTAGCTCCCTACTGCACATCCCCAGA
Sequence Type mRNA
Unitrap ID UNI26903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26666016..26668570 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es