Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST79736
Clone ID OST79736
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST79736
Sequence
ATGGGACGGACATCTAAGGATAAACGGGATGTCTACTACCGCCTGGCCAAGGAGAATGGCTGGCGGGCCCGAAGCGCTTT
CAAGCTCCTGCAACTGGATGAGGAATTCCAACTCTTCAAAGGTGTGAAGCCGAGCCGGTTGACTTGTGTGCAGCCCCAGG
CAGCTGGAGCCAGGTGCTGAGCCAGAAGGTTGGGGGCCAGGGTTCTGGTCAGGTGGTGGCCGTGGACTTACAGGCTATGG
CTCCACTGCCAGGTGTGATACAGATACAGGGCGACATCACTCAGCTTTCCACTGCCAAGGAGATCATCCAGCACTTTGAA
GGCTGCCCTGCTGACCTAGTAGTGTGTGACGGGGCTCCTGATG
Sequence Type mRNA
Unitrap ID UNI21047

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7826105..7828126 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es