Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST79627
Clone ID OST79627
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST79627
Sequence
ACTGAGGAATGAATTCAGAGCATGGGCTGACATCAAGCCTGTGAAACCCATCAAAGCCAAGCCCCAGTACAAGCCCCCAG
ATGACAAGATGGTTCATGAGACCAGCTACAGCGCCCAGTTCAAAGGGGAGGCCAATAAGCCCAGTGCAGCGGACAACAAG
GCCATGGATCGCAGAAGAATACGGAGCCTCTACAGTGAGCCTTTCAAGGAATGCCCGAAGGTAGAGAAACCTAGTGTTCA
GAGTTCCAAACCAAAAAAGACCTCAACGAGCCATAAACCCCCAAGGAAGGCCAAAGACAAGCAGGTGGTGTTCNGGCCAG
GCTGCCAAGAAAAAGACCACAGAGGGCCCCNGTGCTACCAAACCCTACCACAAGGAGCAAAGCTAAGAGATGAACAATAA
ACTGGCTGAGGCGAAAGTATAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI24038

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 106464197..106466183 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055407 (Mtap6) NM_001043355 microtubule-associated protein 6 Gene [Source:MGI (curated);Acc:Mtap6-003]

 
Come back to gene ENSMUSG00000055407


For any suggestions or comments, please send an email to unitrap@crg.es