Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST79475
Clone ID OST79475
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST79475
Sequence
TGAGTGAGATTGGGGTCCCACGGCCAGCTGCTACTCCGCGTCAACCGGGCGTCGCTGAGTCAGGGTCTCCCCGAAGCCTA
CCGCGTGCACCGAGCGCTGCTCCTGCTGACGCCGACGACCCGCCCCTGGGACATCACTAGGCCCCTGAAGCGTGCGCTCA
GCCTCCAGGGACCCCGTGCTCCCGCATTACGCCTGCGCCTGACGCCGCCTCCGGACCTGGCTATGCTGCCCTCTGGCGGC
GCACAGCTGGAACTGCGCTTACGGGTAGCCGCCGGCAGGGGGCGCCGAAGCGCGCATGCGCACCCAAGAGACTCGTGCCC
ACTGGGTCCGGGGCGCTGCTGTCACCTGGAGACTGTGCAGGCAACTCTTGAAGACTTGGGCTGGAGCGACCC
Sequence Type mRNA
Unitrap ID UNI27002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73153688..73154075 378
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038508 (Gdf15) NM_011819 growth differentiation factor 15 Gene [Source:MGI (curated);Acc:Gdf15-002]

 
Come back to gene ENSMUSG00000038508


For any suggestions or comments, please send an email to unitrap@crg.es