Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XI486
Clone ID XI486
Vector pGT1cd72
Project baygenomics

Sequence tag XI486
Sequence
CCACAGGTGATGGACAGAATCTGTTTACTAAAGACGTGACAGTGATTGAAGGAGAAGTGGCAACCATCAGCTGCCAGGTC
AATAAGAGTGACGACTCAGTGATCCAGCTCCTGGAAGCCCCGACAGGCAGACCATTTACTTCAGGGACTTCAGGCCTTTG
AAGGACAGCAGGTTTCAGCTGCTGAATTTTTCTAGCAGTGAACTCAAAGTGTCACTGACGAATGTCTCAATCTCGGATGA
AGGGAGATACTTCTGCCAGCTCTACACGGACCCCCCACAGGAGAGTTACACCACCATCACAGTCCTG
Sequence Type mRNA
Unitrap ID UNI8419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47596052..47597931 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es