Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK236
Clone ID RRK236
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK236
Sequence
CCTAGAAGGGCCTCCTCACAGCGGGAAGACTGCCCTGTCTGCAAAGACTGCCGAGGAATCCAACTTCCCCTTCATCAAGA
TCTGCTCACCTGATAAGATGATTGGCTTCTCCGAGACAGCCAAGTGTCAGGCCATGAAGAAGATCTTTGATGATGCTTAC
AAATCTCAGCTCAGCTGTGTGGTCGTGGATGACATTGAGAGGCTGCTCGATTATGTCCCCATTGGTCCCCGGTTCTCCAA
CCTGGTATTGCAGGCTCTTCTTGTGTTACTGAAAAAGGCGCCTCCT
Sequence Type mRNA
Unitrap ID UNI8441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103707691..103720344 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es