Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST77786
Clone ID OST77786
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST77786
Sequence
GCATCAGAGTCCTAAATGCACAACCCAAGGNTATTCCTTTCCAGAGCGGGTTTCTTCTCCAAACCAGGACTGCTTCCCTG
GGATACTGGAAGACCACCAGATTTGTCACAGTCCTTATTGGGCAGAGCATATAAAGGGAGTTTCACCAGCGTGATAGCTA
AGAAGCACCCAAGCAGACAAAAATATCAGAAGAAACAAAGGCATTGTAGAGATGACTCCTGGCAGGAGAGGCTGGCTGAT
GTTGTGACTCCACTCTGGAGGCTGAGTTATGAAGCACAACTCAAGGTGAAATTTGAAGCTCAGAAGAAACTTTTACAAAG
CCTAGAGTCTCACCTAAAAGTGCTCCATGGAGTCAGTGACACAGTGGCTGCACATCAGTCTGAGGGGCTCCGCTGTCTCC
TCCATCCCATTATACCCTCTCCTACCACCACTGGCTACCGGAACAAGTCCACCTTTTC
Sequence Type mRNA
Unitrap ID UNI24272

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 130798266..130802100 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067369 (4732479N06Rik) NM_172540 TRM2 tRNA methyltransferase 2 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2442530]

 
Come back to gene ENSMUSG00000067369


For any suggestions or comments, please send an email to unitrap@crg.es