Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST77733
Clone ID OST77733
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST77733
Sequence
TGAGGTCCTCTACAGTCTTCAGGGAGGGAGCAAGCCAGGCTCAAGANGAGGCTGCAGGAGCTGCAGCAGCTCAAAAGGGA
GCGCACAGGCTCTCCCGGAGCCAAGATCCCATTCTCAGTACCTGAAGTTCCTCTGGTATTCCAAGGCCAAACTAAGCAGG
GCAGGCAAGTGCCCAAGTTTGTAGTTTCTAACTTGAAGGTCTGCTGCCCTCTGCCTGAAGGTTCTGCTCTGGTCACCTTT
GAGGACCCCAAAGTGGTTGATCGGTTGCTACAACAAAAGGAACACAGAGTTAACTTANAGGACTGCTGGCTGCGGGTGCA
GGTCCAGCCCTTGGAGCTGCCTGTGGTGACCAACATTCAGGTGTCCAGCCAGCCAGATAACCACAGGGTGCTCGTTAGTG
GTTTTCCTGCTGGACTTANGCTGAGTGAANAGGAACTGNTGGACAAGCTGGAAATCTTCTTTGG
Sequence Type mRNA
Unitrap ID UNI13181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101317878..101319037 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010358 (Ifi35) NM_027320 interferon-induced protein 35 Gene [Source:MGI (curated);Acc:Ifi35-001]

 
Come back to gene ENSMUSG00000010358


For any suggestions or comments, please send an email to unitrap@crg.es