Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST77694
Clone ID OST77694
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST77694
Sequence
GAACATGAGACCCCCAACCTAAGGGTGCAATGGCAGTGTCAGCCCCCTTGAGGAGCCTGGAGGAAGAGGTGACCTGCTCC
ATCTGCCTGGNTTACCTGAGGGACCCGGTGACCATCGACTGTGGCCATGTCTTCTGTCGCAGCTGCACAAGTGATATCCG
CCCCATATCGGGGAACCGGCCTGTCTGCCCGCTCTGCAAGAAGCCCTTTAAGAAGGAGAACATCCGACCCGTGTGGCAGC
TAGCAAGTCTGGTGGAGAACATTGAACGGCTTGAAGGTGGACAATGGCAAACAGCCCAGGAGAGCTCGCCCGCGAGCCAC
AGGACATTGAAGTTGTGTGAGCCGGCACCAGGAGAAACTACACTACTACTTGNGAAGATGATGGCAAAATTG
Sequence Type mRNA
Unitrap ID UNI23296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36987608..36987989 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024457 (Trim26) NM_001025599 tripartite motif-containing 26 Gene [Source:MGI Symbol;Acc:MGI:1337056]

 
Come back to gene ENSMUSG00000024457


For any suggestions or comments, please send an email to unitrap@crg.es