Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST77538
Clone ID OST77538
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST77538
Sequence
ATCGCAGGCCCTCTGCTGNCATCTTCTCCCAGGGAGTACCAGAAACATATTAAAAGAACACATGCCAAACATCACACTCC
AGAAGCCGATTGAAAGTTACTACCAGAGGTACCTGAATGGCCGTGGGGAAAAACGGAGCAGCCCCCGTGCTCTTGGAGCT
GGCCAATGAGGTGGACTATGCACCCTCATTAATGGCTCGGATTATCCTGGAGAGATTTCTACAGGGGCATGAACAGACTC
CACCCTNACTGGCTANTTNCTNCNCTCAGGTNCTTANTNGTTTTCTATAACATGNATGNTTGTTACCTTGNNCCAGAATA
AGAATAGATTAGAGCA
Sequence Type mRNA
Unitrap ID UNI21955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 115457669..115468559 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040282 (BC052040) NP_997147 Uncharacterized protein C15orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3U4G0]

 
Come back to gene ENSMUSG00000040282


For any suggestions or comments, please send an email to unitrap@crg.es