Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRQ032
Clone ID RRQ032
Vector pGT1Lxf
Project baygenomics

Sequence tag RRQ032
Sequence
AAGGAAAGATTTCCTTAAATCCTTCTGTTCACCTTAAGGCAGAGAAACTGGAAATGGCTCTCAATTACCTCGGTATACAG
CCAACAAAGGAACAACGTGAAGCCCTGAGAGAGCAAGTCCAGGCCGACTCAAAGGGGACTGTGTCTTTTGGAGATTTCGT
CCAGGTTGCCAGAAGTTTGTTTTGCTTGCAGTTGGATGAAGTAAATGTTGGTGTCCATGAAATCCCCAGCATCTTAGACT
CACAGCTTCTCCCCTGTGATTCTCTAGAAGCAGATGAAGTGGGAAAACTTAGACAAGAAAGAAACGCTGCTCTAGAGGAA
CGGAATGTGCTTA
Sequence Type mRNA
Unitrap ID UNI8451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 90436566..90461555 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020546 (Stxbp4) NM_011505 syntaxin binding protein 4 Gene [Source:MGI (curated);Acc:Stxbp4-001]

 
Come back to gene ENSMUSG00000020546


For any suggestions or comments, please send an email to unitrap@crg.es