Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST77195
Clone ID OST77195
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST77195
Sequence
AGCTGCTGGTGCTTGTGCTGTTCCCAAGCCAAAGGGAAGGAGAGTGCNAGGAAGAACTAGTGGTGGAGTCCCGGTATCTG
CAATATGACAAGAAAGCNAANAAGGGTCCCCCTGGCCTNTGANAAAGAACATCAAAGATGGCTTAACCTC
Sequence Type mRNA
Unitrap ID UNI27037

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73784048..73793174 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035439 (2410004L22Rik) NM_029621 RIKEN cDNA 2410004L22 gene Gene [Source:MGI Symbol;Acc:MGI:1923728]

 
Come back to gene ENSMUSG00000035439


For any suggestions or comments, please send an email to unitrap@crg.es