Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST77128
Clone ID OST77128
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST77128
Sequence
GTGGCAGTGGCAACAACAGCAGTGGCAGAGGCAACAATGGTGGAGCCACAGACCCTGCAGTACAGCGGTCATTCAGCCAG
GTCCCATTATCTACCTTCTCTCCCTCAGCTGCCTCCCCTCAGGCTCCGGCCCTGCAGGTCAAAGTCTCTCCTACCCCACC
AAGGGCAACCCCTGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGATGA
TCACCCCGACGTTCAGCACCGCTCCGCAGACNAGGATTATCCAGCANNCTTTGATATACCAAAACGCANNGACCAGNTTT
CAAGGNGACGCANAAGTCAGGGCACTTGGTGGCTTCCGGAGCCTCCGTGC
Sequence Type mRNA
Unitrap ID UNI8361

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 82000261..82000630 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022463 (Srebf2) NM_033218 sterol regulatory element binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:107585]

 
Come back to gene ENSMUSG00000022463


For any suggestions or comments, please send an email to unitrap@crg.es