Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST77126
Clone ID OST77126
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST77126
Sequence
AGGACTCACTCGCCGNGTGATATCAACTTGCTGATGTTGGGAGACCCTGGTACAGCCNAGNCTCAGCTTCTGAAGTTTGT
GGAGAAGTGCTCTCCCATTGGGGTGTACACATCTGGGAAAGGTAGCAGTGCTGCAGGCTTGACTGCCTCAGTGATACGGG
ACCCCTCATCTCGAAACTTCATCATGGAAGGTGGAGCCATGGTTNTGGCCGATGGTGGGGTTGTCTGTATTNATGAGTTT
NGACAAGATGCGGAAAGATGACCGTTT
Sequence Type mRNA
Unitrap ID UNI27040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 77643166..77644825 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005410 (Mcm5) NM_008566 minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:103197]

 
Come back to gene ENSMUSG00000005410


For any suggestions or comments, please send an email to unitrap@crg.es