Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST77007
Clone ID OST77007
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST77007
Sequence
AGGTTCTGTGGCTCCCANCGTCAGCGGTTTCCATCCTCTCCTCTGGGCCTGGNCTGCCGNCACCACCTTTCANCACCACC
TNCTNCTGGGCCACCTNCACCCTTTGAGAATGAGGATAAAAAGGNGGAGCCCTCCCCTTCTCGCTCAGCTTTATTTGCCC
AGCTCAATCAAGGAGAAGCCATCACTAAAGGGCTCCGGCATGTCACAGATGACAAGAAGACATACAAGAATCCCAGCCTG
AGGGCTCAAGGACAGATTCGCTCTCCAACCAAAACTCACATGCCGAGCCCCACATCTTCCAAAATCGAATTCTCCTCAGA
AACATACTCCAGTGTTGGAGCTGGAAGGGAAGAAGTGGAGAGTGGAATACCAAGAGGACAGGAATGACCTTGTCATCTCC
GAGACCGAGCTGAAACAAGTGGGCTTACATTTTTCAAATGTGACAAATCCACT
Sequence Type mRNA
Unitrap ID UNI27042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 46730990..46735278 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021373 (Cap2) NM_026056 CAP, adenylate cyclase-associated protein, 2 (yeast) Gene [Source:MGI (curated);Acc:Cap2-001]

 
Come back to gene ENSMUSG00000021373


For any suggestions or comments, please send an email to unitrap@crg.es