Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRQ144
Clone ID RRQ144
Vector pGT1Lxf
Project baygenomics

Sequence tag RRQ144
Sequence
AAACACCGACTCGCAGACTTTGCGCTTGGGGAGACGTGTAGAGTCCTGGGTTTGGCCTTTTTTTAATTTTCTTTTTTTTT
TTTTTTTTTGCTCTTTCCGGGACAAGATGGCGCCGTCCACACCGCTGTTGACAGTCAGAGGATCAGAGGGACTGTACATG
GTGAATGGACCACCACACTTCACAGAAAGCACGGTGCTTC
Sequence Type mRNA
Unitrap ID UNI8460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58329877..58335074 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es