Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST76802
Clone ID OST76802
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST76802
Sequence
GAGCGTGGATTCTTCTNCACACCCATGTCCCGCCGCGANGTGGAGGACCCACAAGGTGTGCCAGGAGAGGAAAAGCAGCC
AGTACCCACGCCCGACCTGGTGGAGGCAGAAGTGGGCAGCACAGCCCTTCTCAAGTGTGGCCCCTCACGGGCCTCAGGCA
ACTTCAGCCAAGTGGACTGGTTTTTGATTCACAAGGAGAGGCAGATACTGATTTTCCGTGTGCACCAAGGCAAGGGCCAG
CGGGAACCTGGTGAATATGAGCACCGCCTTAGCCTCCAAGACTCGGTGGCTACTCTGGCCCTGAGTCACGTCACTCCCCA
TGATGAGCGAATGTTCCTGTGTAAGAGCAAGCGACCACGGCTCCAGGATCACTACGTTGAGCTTCAGGTCTTCAAAGCCC
CAGAGGAACCAACTATTCAAGCCAATGTCGTGGGCATCCATGTGGACAGGCAAGAGCTCAGGGAGGTTGCTACCTGTGTG
GGGAGTT
Sequence Type mRNA
Unitrap ID UNI27046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43944599..43945320 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032135 (Mcam) NM_023061 melanoma cell adhesion molecule Gene [Source:MGI (curated);Acc:Mcam-001]

 
Come back to gene ENSMUSG00000032135


For any suggestions or comments, please send an email to unitrap@crg.es