Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST76707
Clone ID OST76707
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST76707
Sequence
AACTCGAGGTTTGTAAATATTATNCTCTGCGGNTTTTGTCCTGCGGAATTGTTCACAAATACCCGNTCTGATCTTGGNCC
ATGNGAAAAAATTCATGATGAAAATCTAAGAAAACAGTATGAGAAGAGTTCTCGCTTTATGAAAGTTGGCTATGAGAGAG
ATTTTTTGCCGATACTTACAGAGTTTACTTGCCCGAGGTAGAGCGCANAATTAGACGAGGTCATGCTNGGTTGGCATTAT
CTCAAAATCAGCAGTCTTCTGGGGCTGCTGGTCCAACAGGCAAAAATGAAAAAA
Sequence Type mRNA
Unitrap ID UNI23693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 94162863..94171007 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020863 (3300001P08Rik) NM_026313 RIKEN cDNA 3300001P08 gene Gene [Source:MGI Symbol;Acc:MGI:1914934]

 
Come back to gene ENSMUSG00000020863


For any suggestions or comments, please send an email to unitrap@crg.es