Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST76192
Clone ID OST76192
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST76192
Sequence
CTGAGCTCCTGCCCCCCCAAAGCCGAAGCCAAAGCGAAGGCCTTGAAAGCTAAGAAGGCGGTGCTGAAAGGCGTCCACAG
CCACAAAAAGAAGAAGATCCGAACGTCACCCACCTTCCGGCGGCCCAAGACCCTGCGGCTCCGGAGGCAGCCAAAATATC
CTCGGAAGAGTGCGCCCAGGAGAAACAAGTCAGTAGGGACCCTGGACCCAGTAGCATGTAGTAGGGCATTAGGAGTTCTT
AACGTAGCTTCCTTATAAAACACAATTGTTGAAGGAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77996215..77996490 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058546 (Rpl23a) NM_207523 ribosomal protein L23a Gene [Source:MGI (curated);Acc:Rpl23a-001]

 
Come back to gene ENSMUSG00000058546


For any suggestions or comments, please send an email to unitrap@crg.es