Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST75941
Clone ID OST75941
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST75941
Sequence
AACTGAGAAGCCCGCCCCTGCCAAGGTGGACGCGAAGCCGAAAAAGGCCGCGGGAAAGGATAAAGCATCAGACAAAAAAG
TGCAGATAAAAGGGAAGAGGGGAGCGAAGGGCAAACAGGCTGACGTGGCTGACCAGCAAACCACAGAGCTGCCTGCAGAA
AATGGAGAGACGGAAAACCAGAGTCCAGCCTCTGAAGAAGAGAAAGAAGCTAAGTCCGACTAAGCATCCATCACGTCTGT
CAGTGGTCCCGCCTCCCTTCTTGTACAATCCAGAGGAATATTTTTATCAACTATTTTGTAAATGCGAGTTTTTTAGTAGC
TCTAGATC
Sequence Type mRNA
Unitrap ID UNI23560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 96343880..96348812 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040681 (Hmgn1) NM_008251 high mobility group nucleosomal binding domain 1 Gene [Source:MGI (curated);Acc:Hmgn1-001]

 
Come back to gene ENSMUSG00000040681


For any suggestions or comments, please send an email to unitrap@crg.es