Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST753
Clone ID RST753
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST753
Sequence
CCGTAGCTTTCCAGCCTCCGCCTCGGACCCTGCAGCCGCCGC
Sequence Type mRNA
Unitrap ID UNI8477

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27772150..27772185 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052146 (Rps10) NM_025963 ribosomal protein S10 Gene [Source:MGI (curated);Acc:Rps10-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20822715..20822750 36
NO GENE  

 
Come back to gene ENSMUSG00000052146


For any suggestions or comments, please send an email to unitrap@crg.es