Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST75682
Clone ID OST75682
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST75682
Sequence
ACTGAGAACGCAGTGACNTACTATGATGTCCTGGTGANCTTTACTCAAGAAATAATGGGGTTTGCTGGATCCTTCCCAAA
ANAGNCTNTACAAANATGTGATGCTCNAAACCTATAGGAACCTCACTGCCCTAGGCTATAACTGGGAAGAAGATAATATT
GAAGAAGATTGTGAAAATTCTGGAAGACCCACTAGGCATCTTCAAAGGGATGGACCAAGTAATACTGGAGAGAAACCCTT
TGAATGTATTCAATATGATGGAGCCTTTGCAAGAAACCATCATCAGTTACATAAGGACACTGGATCTTTCATGTCTTATA
CTGATCGNCAAATACATAGAAGACCACACACTGNAGAAAAAGTCTATGATGGNAACCAATGGGGGGAAACCTTTTCATGT
CACAACCATTTTGAAATCCCGNAAGGAACATATACTGGAGAAAAACCCTATGAATGNAATCAATGNGGGAAAGCCTTTGC
NCCCCCAGCAATCTTTTTGACCNTNAAAGAATACCTNCTGGAGAAGAAACCCTAT
Sequence Type mRNA
Unitrap ID UNI16023

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17222483..17224547 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067034 (Zfp97) NP_001005358 zinc finger protein 97 Gene [Source:MGI Symbol;Acc:MGI:105921]

 
Come back to gene ENSMUSG00000067034


For any suggestions or comments, please send an email to unitrap@crg.es