Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0677
Clone ID BC0677
Vector pGT2lxr
Project sanger

Sequence tag BC0677
Sequence
TTCCACCTCCTCCGCATATCTTCGATCCTAATCTTCCTATTCAGCTCGATTCCGGCGGCAGCGCGACGTCCCTCACTTAC
GGCCGAAGCGGTTCGCGCTGTGAGTCGGTGGCGCCGTGCAGGGCACTTAGGAACCGACAGCCTTGGCGCGGACTGGTATC
CGGTTGATTGCGGTTTGCAGGGTCCGCCATGGAGTCGGAGCAGATGCTGGAGGGACAGACACAGGTTGCAGAAAACCCTC
ACTCTGAGTACGGGCTCACAGACAGCGTTGAGAGAATAGTCGAAAATGAGAAGATTAATGCAGAAAAGTCATCGAAACAG
AAGGTGGATCTACAGTCCTTGCCCACCCGTGCCTACCTGGACCAGACAGTTGTGCCTATCTTATTACAGGGACTTGCTGT
GCTTGCCAAGGAAAG
Sequence Type mRNA
Unitrap ID UNI894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74707060..74715783 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es