Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRO020
Clone ID RRO020
Vector pGT2Lxf
Project baygenomics

Sequence tag RRO020
Sequence
GTGGAAGCCCAGATAGCGGCGGAGAGGGCTTCGGATCCCATGGCGACCCCGGAGGCCAGCGGCAGTGGCGAGAAGGTCGA
GGGCTCCGAGCCCTCCGTCACCTACTACCGGCTGGAGGAGGTGGCGAAGCGAAACTCGGCGGAAGAGACGTGGATGGTGA
TCCACGGGCGAGTCTACGATATCACCCGCTTCCTCAGCGAGCATCCTGGCGGGGAAGAGGTTCTGCTGGAACAAGCGGGT
GCTGATGCAACTGAAAGCTTTGAAGATGTCGGCCACTCCCCTGATGCCAGGGAGATGCTAAAGCAGTACTACATTGGAGA
TGTCCATCCGAGTGACCTTAAACCTAAAGGCGATGACA
Sequence Type mRNA
Unitrap ID UNI8478

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109674573..109694318 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031924 (Cyb5b) NM_025558 cytochrome b5 type B Gene [Source:MGI Symbol;Acc:MGI:1913677]

 
Come back to gene ENSMUSG00000031924


For any suggestions or comments, please send an email to unitrap@crg.es