Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRK454
Clone ID RRK454
Vector pGT2Lxf
Project baygenomics

Sequence tag RRK454
Sequence
CGTTTTGGCTCCAACAAGGGAATTGGCAAATCAAGTAGCCAAAGATTTCAAAGATATAACTAGAAAACTCAGTGTGGCGT
GTTTTTATGGTGGAACATCATATCAAAGCCAGATTAATCAAATTCGGAATGGTATTGACATCCTTGTTGGGACCCCAGGG
CGTATCAAAGACCATCTGCAAAGTGGCCGTTTGGATCTTTCAAAGCTACGCCATGTTGTGCTTGATGAAGTAGATCAAAT
GTTAGATTTAGGTTTTGCTGAACAAGTCGAAGATATTATTCATGAATCTTACAAAACTGATTCGGAAGACAATCCTCAGA
CCTTACTTTTTTCTGCAACTTGCCCACAGTGGGTATACAAAGTTGCAAAAAAATACATGAAATCCAGATACGAACAGGTT
GACCTTGTTGGAAAAATGACTCAAAAAGCTGCAACCACTGTGGAA
Sequence Type mRNA
Unitrap ID UNI8481

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62102609..62103605 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020076 (Ddx50) NM_053183 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 Gene [Source:MGI Symbol;Acc:MGI:2182303]

 
Come back to gene ENSMUSG00000020076


For any suggestions or comments, please send an email to unitrap@crg.es