Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST75541
Clone ID OST75541
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST75541
Sequence
TGAGGAATGGAAGAAAGCAGGAGTTGAGCAGCTACGGCTCAAGCACACGTCGACATGACTGGGGTCCCAACCTTGGCCAA
TCTCCACAAAGGAGTCCAGTTTGCTCTCAAGTACCAGGCACTGGGCCAGTGTGTCTATGTGCATTGTAAGGCTGGTCGAT
CCAGAANTGCCACAATGGTGGCAGCCTATCTGATTCAGGTACACAACTGGAGCCCAGAGGAGGCTATTGAAGCGATCGCC
AAAATCCGGTCACACATCTTCATTAAGCCCAGCCAGNTTGGAAGTTCTCAAAGAGTTCCNCAAGGANATNACTGCAAGGG
CAGCAAAAAA
Sequence Type mRNA
Unitrap ID UNI27056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 90751346..90754334 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063235 (Ptpmt1) NP_079852 protein tyrosine phosphatase, mitochondrial 1 Gene [Source:MGI (curated);Acc:Ptpmt1-001]

 
Come back to gene ENSMUSG00000063235


For any suggestions or comments, please send an email to unitrap@crg.es